You are 3703838 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
3Q1Q NA0948 B, C1HYDROLASE/RNAX-Ray Difraction3.82010-12-17


model 1
>strand_B
gGAGAGGAGCAGGCGGUCGCGGGGGCGCACACCUGCGCUCCCGAGGAAAGUCCGGACUCUGGAGCGGGGUGCCGGGUAACGCCCGGGAGGGGUGACCCUCGGACAGGGCCAUAGAGAAGAAGACCGCCCGGGGGGAAACUUCCGGGCAAGGGUGGAACGGUGGGGUAAGAGCCCACCAGCGUCGGGGCAACCCGGCGGCUUGGCAACCCCCACCUGGAGCAAGGCCAAGCAGGGGGUUGGGUCGCUCCCCUAUUCCCCCGGGUUGGCCGCUUGAGGUGUGCGGUAACGCACACCCCAGAUUGAUGACCGCCACAGAAUCCGGCUUAUGCUCCUCUCCCGUG
((((((((((..(((((..((((((((((....)))))))))).<...[..[[[[[(((([[[[[.((((((((((.....)))))(((((....)))))((...(((((.............(((((((((((....)))))))))..)).......((((((.......))))))(.(((((((....)))))))..).)))..)))))))))))))...((((.....(((.(..(((..]]]]])))...).))).{{{.))))......((((((((....))))))))...........)))))..>....]]]]].]...))))))))))....
>strand_C
GGCCAGGUAGCUCAGGGAGAGCACUGGAUAUGGGCACCCCCUAAGUCCAGGUGCGGCGGUUCGAUUCCGCCCCUGGCCACCA
(((((((..((((.....)))).((((((..(((....)))...))))))....(((((.......))))))))))))}}}.