You are 3231471 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2W2H 2W2H R, S1RNA-BINDING PROTEINX-Ray Difraction3.252008-10-30


model 1
>strand_R
GCUCAGAUUCUGCGGUCUGAGC
.....(....(..)..).....
>strand_S
GCUCAGAUUCUGCGGUCUGAGC
.....(....(..)..).....