You are 3231465 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2VPL 2VPL B, D1TRANSLATIONX-Ray Difraction2.32008-03-01


model 1
>strand_B
gGAGUGAAGGAGGCUCGCGAACUCGCGAAGCCGAGAAACUUCACUCCC
(((((((((..(((((((......))).))))......))))))))).
>strand_D
GGAGUGAAGGAGGCUCGCGAACUCGCGAAGCCGAGAAACUUCACUCCC
.((((((((..(((((((..--..))).))))......))))))))..