Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4699054
visitor.
Currently
21
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2VPL
2VPL
B, D
1
TRANSLATION
X-Ray Difraction
2.3
2008-03-01
model 1
>strand_B
gGAGUGAAGGAGGCUCGCGAACUCGCGAAGCCGAGAAACUUCACUCCC
(((((((((..(((((((......))).))))......))))))))).
>strand_D
GGAGUGAAGGAGGCUCGCGAACUCGCGAAGCCGAGAAACUUCACUCCC
.((((((((..(((((((..--..))).))))......))))))))..