You are 3216637 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2QBZ UR0120 X1RNAX-Ray Difraction2.62007-06-18


model 1
>strand_X
GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAAUCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCUUGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCCA
((((((((([.(((..(((..((((((((......(((((((((((....((((....))))....))))).....(((((((((......])))))))))..).))))).(.--------.)....)))))))).)))...)))..))....))))))).