You are 3231474 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2OWO PD0978 B, C, D1LIGASE/DNAX-Ray Difraction2.32007-02-16


model 1
>strand_B
cauuccgauaguggggucgcaauugu
((((((((((((((((((((((((((
>strand_C
acaauugcgaccc
)))))))))))))
>strand_D
cacuaucggaauga
))))))))))))).