You are 3231463 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2OM7 A, B, C, D, F, G, H, I, J, M1RIBOSOMEElectron Microscopy7.32007-01-21


model 1
>strand_A
cUCCUACGGGAG
((((....))))
>strand_B
UUCCGCAAUGGGCGCAAGCCUGACGGAG
(.(((------------------)))).
>strand_C
GCCCGUCACGCCAUGGGAGCGGGCUCUACCCGAAGUCGCCGGGAGCCUACGGGCAGGCGCCGAGGGUAGGGCCCGUGACUGGGGCGAAGUCGUAAC
(..((.(.((((.(((..(((((((((((((...(.(((.....(.(....).)..))).)..)))))))))))))..))).))))..).))...)
>strand_D
GACAUGCAAGUCGUGCGGGCCGCGGGGUUUUACUCCGUGGUCAGCGGCGGACGGGUGAGUAACGCGUGGGUGACCUACCCGGAAGAGGGGGACAACCCGGGGAAACUCGGGCUAAUCCCCCAUGUGGACCCGCCCCUUGGGGUGUGUCCAAAGGGCUUUGCCCGCUUCCGGAUGGGCCCGCGUCCCAUCAGCUAGUUGGUGGGGUAAUGGCCCACCAAGGCGACGACGGGUAGCCGGUCUGAGAGGAUGGCCGGCCACAGGGGCACUGAGACACGGGCCCCACUCCUACGGGAGGCAGCAGUU
((...(.--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------.)..))
>strand_F
CUCUUCCUAGUACGAGAGGACCGGAAGGG
..(((((.....(....)....)))))..
>strand_G
GUGCCGGAAGGUCAAGGGGAGGGGUGCAAGCCCCGAACCGAAGCCCCGGUGAAC
(((((((..(((...((...(((((....)))))...))...))))))))..))
>strand_H
GCUGAUCUCCCCCGAGCGUCCACAGCGGCGGGGAGGUUUGGC
(((.((((((((...((.......))...)))))))..))))
>strand_I
GCCAGGAGGUUGGCUUAGAAGCAGCCAUCCUUUAAAGAGUGCGUAAUAGCUCACUGGU
((.((.(.(..(.............)..).)......................)).))
>strand_J
GCUCUUGGUCGCGCCUGCGUAGGAUAGGUGGGAGCCUGUGAACCCCCGCCUCCGGGUGGGGGGGGAGCGCCGGUGAAAUACCACCCUGGCGCGGCUGGGGGC
(((((((..(..(((.(.........(((((.......--------------------------.--............-)))))).)))..)..)))))))
>strand_M
UCCGUGAuAACAAAGCGGuuAUGUACCGGAUUUUUAUUCCGGCUAUcGGGGuuCAAUUCCCCGUCGCGGAGCCA
(((((((..(((.....[...))).(((((.......)))))....(((((..]....))))))))))))....