You are 3231459 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2O5J PH0037 G, H, I, X, Y, Z1TRANSFERASE/DNA-RNA HYBRIDX-Ray Difraction32006-12-06


model 1
>strand_G
cccugucuggcguucgcgcgccg
(((((((((((((.(((((((((
>strand_H
GAGUCUGCGGCGCGCG
.......)))))))))
>strand_I
aacgccagacaggg
-)))))))))))))
>strand_X
cccugucuggcguucgcgcgccg
(((((((((((((.(((((((((
>strand_Y
GAGUCUGCGGCGCGCG
.......)))))))))
>strand_Z
aacgccagacaggg
-)))))))))))))