You are 3216628 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2NVT PH0033 R, T, N1TRANSCRIPTION,TRANSFERASE/DNA-RNA HYBRIDX-Ray Difraction3.362006-11-13


model 1
>strand_R
aAGACCAGGC
..((((((.(
>strand_T
caaguacuuacgccuggucuu
..[........).))))))..
>strand_N
guacuug
....]..