You are 3231474 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2NVQ PH0031 R, T, N1TRANSCRIPTION,TRANSFERASE/DNA-RNA HYBRIDX-Ray Difraction2.92006-11-13


model 1
>strand_R
aUCGAGAGGa
.(((((((((
>strand_T
cuaccgauaagcagacgauccucucgau
..[[.[[.[.[.......))))))))).
>strand_N
cugcuuaucgguag
...].].]].]]..