You are 3231473 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2NOQ A, B, C, D, E1RIBOSOMEElectron Microscopy7.32006-10-26


model 1
>strand_A
aAAAAUGUGAUCUUGCUUGUAAAUACAAUUUUGAGAGGUUAAUAAAUUACAAGUAGUGCUAUUUUUGUAUUUAGGUUAGCUAUUUAGCUUUACGUUCCAGGAUGCCUAGUGGCAGCCCCACAAUAUCCAGGAAGCCCUCUCUGCGGUUUUUCAGAUUAGGUAGUCGAAAAACCUAAGAAAUUUACCUGCU
(((((........(((((((((.(........[[[[[.......).)))))))))......))))).....[[[[[.((((....)))).....((((.((((]]]]]((((.....))))...)))).))))...]]]]]...(...((((.....[.[[[[..))))...)........]]]].]...
>strand_B
gCGCCGGCCAACUCCGUGCCAGCAGCCGCGGUAAUACGGAGGGCGC
((((([[[...(((((.....((.]]])).......))))))))))
>strand_C
gCUGCAUGGCCGU
(((...((((((.
>strand_D
UCUGGUCAGCAUGGC
.).)))...)).)))
>strand_E
GGGAUGCGUAGGAUAGGUGGGAGCGCAAGCGCCGGUGAAAUACCACCCUUCCC
((((.(......[..(((((..((....))..........].)))))).))))