Search
Structural elements
Secondary structures
Help
About
References
Links
You are
4700710
visitor.
Currently
8
users online.
Supported by:
Institute of Computing Science
,
Poznan University of Technology
Institute of Bioorganic Chemistry
,
Polish Academy of Sciences
Sequence & secondary structure in dot-bracket notation
PDB id
NDB id
Strands
Number of models
Functional class
Experimental method
Resolution [Å]
PDB deposition
2N2P
A
10
RNA
NMR
2015-05-11
models:
1
2
3
4
5
6
7
8
9
10
model
1
,
2
,
3
,
4
,
5
,
6
,
7
,
8
,
9
,
10
>strand_A
GCAUGUUUAGUGUCUAAACGGUU
....((((((...))))))....