You are 3216620 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2LJJ 2LJJ A20RNANMR2011-09-15



models:   1   2   3   4   5   6   7   8   9   10   11   12   13   14   15   16   17   18   19   20

 model 1 
>strand_A
GGCCUCAGCACUACCCCAGUGUAGGUC
((((...(((((.....))))).))))
 model 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 
>strand_A
GGCCUCAGCACUACCCCAGUGUAGGUC
((((...((((.......)))).))))
 model 8 
>strand_A
GGCCUCAGCACUACCCCAGUGUAGGUC
((((...(.((.......)).).))))