You are 3216618 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2H0Z UR0094 A, B1RNAX-Ray Difraction2.72006-05-15


model 1
>strand_A
aGCGCCGGACUUAAAGCCAUUGCACU
..[[[[[(((((((((((..------
>strand_B
CCGGCUUUAAGUUGACGAGGGCAGGGUUUAUCGAGACAUCGGCGGGUGCCCUGCGGUCUUCCUGCGACCGUUAGAGGACUGGAAAACCACAGGCGACUGUGGCAUAGAGCAGUCCGGGCAGGAA
--)))))))))))..[[[...((((((...]]]......]]]]]...))))))[[[[[.((((((]]]]].....((((((.....((((((....)))))).......))))))..)))))).