You are 3231471 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2G5K DR0030 A, B1RNAX-Ray Difraction2.82006-02-23


model 1
>strand_A
UuGCGUCGCUCCGGAAAAGUCGC
-.(((.(..((((((...(.(((
>strand_B
UUGCGUCGCUCCGGAAAAGUCGC
-.))).)..))))))...).)))