You are 3216629 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2EZ6 PR0185 C, D1HYDROLASE/RNAX-Ray Difraction2.052005-11-10


model 1
>strand_C
AAAGGUCAUUCGCAAGAGUGGCCUUUAU
(((((((((((....)))))))))))((
>strand_D
AAAGGUCAUUCGCAAGAGUGGCCUUUAU
(((((((((((....)))))))))))))