You are 3231472 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2ET8 DR0018 A, B1RNAX-Ray Difraction2.52005-10-27


model 1
>strand_A
CgCGUCACACCGGUGAAGUCGC
-(((.(.((((((((..(.(((
>strand_B
CGCGUCACACCGGUGAAGUCGC
-))).).))))))))..).)))