You are 3216608 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2E2I PH0029 R, T, N1TRANSCRIPTION,TRANSFERASE/DNA-RNA HYBRIDX-Ray Difraction3.412006-11-14


model 1
>strand_R
aUCGAGAGGa
...[[...[[
>strand_T
cuaccgauaagcagacgcuccucucgau
(.(((((((((((.....]]...]]...
>strand_N
cugcuuaucgguag
.))))))))))).)