You are 3216610 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2DU3 PR0219 D1LIGASE/RNAX-Ray Difraction2.62006-07-20


model 1
>strand_D
GCCAGGGUGGCAGAGGGGCUUUGCGGCGGACUGCAGAUCCGCUUUACCCCGGUUCGAAUCCGGGCCCUGGC
.((((((..(((.........)))..((((.......))))......(((((.......))))))))))).