You are 3231475 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2DR7 PR0214 B1TRANSFERASE/RNAX-Ray Difraction2.82006-06-08


model 1
>strand_B
GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCAC
((((((((((((.......))))))))))))..