You are 3216634 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2DR5 PR0213 B1TRANSFERASE/RNAX-Ray Difraction2.82006-06-08


model 1
>strand_B
GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCA
(((((((..(((.......)))..))))))).