You are 3231474 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2DER PR0192 C, D1TRANSFERASE/RNAX-Ray Difraction3.12006-02-17


model 1
>strand_C
GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGCCA
......(..((((.........)))).(((((.......))))).....((((.......)))).)........--
>strand_D
GUCCCCUUCGUCUAGAGGCCCAGGACACCGCCCUUUCACGGCGGUAACAGGGGUUCGAAUCCCCUAGGGGACGCCA
--.((((..((((.........)))).(((((.......)))))....(((((.......)))))))))....---