You are 3216631 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2CV0 PR0163 C, D1LIGASE/RNAX-Ray Difraction2.42005-05-31


model 1
>strand_C
GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
(((((((..((((........)))).(((((.......)))))....(((((.......))))))))))))....
>strand_D
GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA
(((((((..((((........)))).(((((.......)))))....(((((.......))))))))))))....