You are 3033339 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1VFG PR0124 C, D1TRANSFERASE/RNAX-Ray Difraction2.82004-04-13


model 1
>strand_C
GGCCAGGUAGCUCAGUUGGUAGAGCACUGGACUGAAAAUCCAGGUGUCGGCGGUUCGAUUCCGCCCCUGGCCACC
(.(((..-----------------------------------------..((.........))....))).)---
>strand_D
GGCCAGGUAGCUCAGUUGGUAGAGCACUGGACUGAAAAUCCAGGUGUCGGCGGUUCGAUUCCGCCCCUGGCCACC
(.(((..-----------------------------------------..((.........))....))).)...