You are 3033018 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1U2A 1U2A A1RNANMR1997-08-19


model 1
>strand_A
GGUCAGUGUAACAACUGACC
(((((((......)))))))