You are 3032965 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1TFN 1TFN A1RNANMR1996-07-10


model 1
>strand_A
gggacugacgaucacgcagucuau
..(((((.((....)))))))...