You are 3033965 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1RY1 E, A, M, N, O, P, Q, R1TRANSLATIONElectron Microscopy122003-12-19


model 1
>strand_E
ngGCCGGGCGCGGUGGCGCGCGCCUGUAGUCCCAGCUACUCGGGAGGCUC
-(((((((((((..[[[.)))))))....((((.]]..]..)))))))).
>strand_A
gACACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCAGGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGUc
((((((..(.(((((((..((..((((..((((((....))))))..))))..))........(.(((((.....((((....(((....)))....))))...))))))))))))).)...))))))
>strand_M
AGGCUGGAGGAUCGCUUGAGUCCAGGA
((((.((....(((((...((.((((.
>strand_N
CCUGUGCAACAUAGCGAGACCCCGUCUCUUu
)))).)).....)))))...)).))))....
>strand_O
GUUCUGGGCUGUAGUGCGCUAUGC
...(((((.(((((((.(((((..
>strand_P
CAAUAGCCACUGCACUCCAG
-.)))))))))))).)))))
>strand_Q
CGAUCGGGUGUC
..((.(((((..
>strand_R
AUCGCGCCUGUG
....))))))).