You are 3032956 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1R9T PH0007 R, T, N1TRANSCRIPTION/DNA-RNA HYBRIDX-Ray Difraction3.52003-10-30


model 1
>strand_R
aUCGAGAGGA
...[[.[[[[
>strand_T
cuaccgauaagcagacgauccucucgau
((((.(((((((......]]]].]]...
>strand_N
cugcuuaucgguag
..))))))).))))