You are 3032534 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1QVF RR0080 0, 9, 31RIBOSOMEX-Ray Difraction3.12003-08-27


model 1
>strand_0
UUGGCUACuAUGCCAGCUGGUGGAUUGCUCGGCUCAGGCGCUGAUGAAGGACGUGCCAAGCUGCGAUAAGCCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGGAUUUCCGAAUGAGAAUCUCUCUaACAAUUGCUUCGCGCAAUGAGGAACCCCGAGAACUGAAACAUCUCAGUAUCGGGAGGAACAGAAAACGCAAUGUGAUGUCGUUAGUAACCGCGAGUGAACGCGAUACAGCCCAAACCGAAGCCCUCACGGGCAAUGUGGUGUCAGGGCUACCUCUCAUCAGCCGACCGUCUCGACGAAGUCUCUUGGAACAGAGCGUGAUACAGGGUGACAACCCCGUACUCGAGACCAGUACGACGUGCGGUAGUGCCAGAGUAGCGGGGGUUGGAUAUCCCUCGCGAAUAACGCAGGCAUCGACUGCGAAGGCUAAACACAACCUGAGACCGAUAGUGAACAAGUAGUGUGAACGAACGCUGCAAAGUACCCUCAGAAGGGAGGCGAAAUAGAGCAUGAAAUCAGUUGGCGAUCGAGCGACAGGGCAUACAAGGUCCCUCGACGAAUGACCGACGCGCGAGCGUCCAGUAAGACUCACGGGAAGCCGAUGUUCUGUCGUACGUUUUGAAAAACGAGCCAGGGAGUGUGUCUGCAUGGCAAGUCUAACCGGAGUAUCCGGGGAGGCACAGGGAAACCGACAUGGCCGCAGGGCUUUgCCCGAGGGCCGCCGUCUUCAAGGGCGGGGAGCCAUGUGGACACGACCCGAAUCCGGACGAUCUACGCAUGGACAAGAUGAAGCGUGCCGAAAGGCACGUGGAAGUCUGUUAGAGUUGGUGUCCUACAAUACCCUCUCGUGAUCUAUGUGUAGGGGUGAAAGGCCCAUCGAGUCCGGCAACAGCUGGUUCCAAUCGAAACAUGUCGAAGCAUGACCUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUGUGUCCGCCUCCGAGAGGAGUCGGCACAcCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGGAUUCCGGUGCGCGGGGUAAGCCUGUGUACCAGGAGGGGAACAACCCAGAGAUAGGUUAAGGUCCCCAAGUGUGGAUUAAGUGUAAUCCUCUGAAGGUGGUCUCGAGCCCUAGACAGCCGGGAGGUGAGCUUAGAAGCAGCUACCCUCUAAGAAAAGCGUAACAGCUUACCGGCCGAGGUUUGAGGCGCCCAAAAUGAUCGGGACUCAAAUCCACCACCGAGACCUGUCCGUACCACUCAUACUGGUAAUCGAGUAGAUUGGCGCUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUGACGAAAAUCCUGGCCAUAGUAGCAGCGAUAGUCGGGUGAGAACCCCGACGGCCUAAUGGAUAAGGGUUCCUCAGCACUGCUGAUCAGCUGAGGGUUAGCCGGUCCUAAGUCAUACCGCAACUCGACUAUGACGAAAUGGGAAACGGGUUAAUAUUCCCGUGCCACUAUGCAGUGAAAGUUGACGCCCUGGGGUCGAUCACGCUGGGCAUuCGCCCAGUCGAACCGUCCAACUCCGUGGAAGCCGUAAUGGCAGGAAGCGGACGAACGGCGGCAUAGGGAAACGUGAUUCAACCUGGGGCCCAUGAAAAGACGAGCAUAGUGUCCGUACCGAGAACCGACACAGGUGUCCAUGGCGGCGAAAGCCAAGGCCUGUCGGGAGCAACCAACGUUAGGGAAUUCGGCAAGUUAGUCCCGUACCUUCGGAAGAAGGGAUGCCUGCUCCGGAACGGAGCAGGUCGCAGUGACUCGGAAGCUCGGACUGUCUAGUAACAACAUAGGUGACCGCAAAUCCGCAAGGACUCGUACGGUCACUGAAUCCUGCCCAGUGCAGGUAUCUGAACACCUCGUACAAGAGGACGAAGGACCUGUCAACGGCGGGGGUAACUAUGACCCuCUUAAGGUAGCGUAGUACCUUGCCGCAUCAGUAGCGGCUUGCAUGAAUGGAUUAACCAGAGCUUCACUGUCCCAACGUUGGGCCCGGUGAACUGUACAUUCCAGUGCGGAGUCUGGAGACACCCAGGGGGAAGCGAAGACCCUAUGGAGCUUUACUGCAGGCUGUCGCUGAGACGUGGUCGCCGAUGUGCAGCAUAGGUAGGAGACACUACACAGGUACCCGCGCUAGCGGGCCACCGAGUCAACAGUGAAAUACUACCCGUCGGUGACUGCgACUCUCACUCCGGGAGGAGGACACCGAUAGCCGGGCAGUUUGACUGGGGCGGUACGCGCUCGAAAAGAUAUCGAGCGCGCCCUAUGGCUAUCUCAGCCGGGACAGAgACCCGGCGAAGAGUGCAAGAGCAAAAGAUAGCUUGACAGUGUUCUUCCCAACGAGGAACGCUGACGCGAAAGCGUGGUCUAGCGAACCAAUUAGCCUGCUUGAUGCGGGCAAUUGAUGACAGAAAAGCUACCCUAGGGAUAACAGAGUCGUCACUCGCAAGAGCACAUAUCGACCGAGUGGCUUGCUACCUCGAUGUCGGUUCCCUCCAUCCUGCCCGUGCAGAAGCGGGCAAGGGUGAGGUUGUUCGCCUAUUAAAGGAGGUCGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUCGGCUGCUAUCUACUGGGUGUGUAAUgGUGUCUGACAAGAACGACCGUAUAGUACGAGAGGAACUACGGUUGGUGGCCACUGGUGUACCGGUUGUUCGAGAGAGCACGUGCCGGGUAGCCACGCCACACGGGGUAAGAGCUGAACGCAUCUAAGCUCGAAACCCACUUGGAAAAGAGACACCGCCGAGGUCCCGCGUACAAGACGCGGUCGAUAGACUCGGGGUGUGCGCGUCGAGGUAACGAGACGUUAAGCCCACGAGCACUAACAGACCAAAGCCAUCAU
--------...(((((((((.....(((..((((((((.(((......((((((.[[..[[.))).....((((((...(((]]..]].)))......))))))...)))....(((...)))(--.)..(((((.....))))).))...((((((.....(...[..)......))))).).........((.....))...(((((.....((.]...))....)))))...((((...((..(((((....))))....))).....((((((((......(..(.....(((((((....({((((......)))))[[(...).(((....}]])))....)))))))......)..)...)))))).)).)....(((((((........)))))))......(((((.[[[[[[)))))..)))......)..)))))).))...............((....))....))......(...(((.....))).............)).....)))))))))......(.((((((((((....((((((..((....(....(((((....))))).....)...))..))))..)).)))))))))).<.(((........))).((((((....(((((((((((((..(((...((((.....))))...)))...((....))..(..((((...((((..-))))...)))))((((((....))))))...)))))))))))))..((.(...((((((.....((((((((((.((((...(((((((....)))))))...).)))....(((..((.((........)))).)))..).))))))))).(.(((.....)))...)..))))))......).))..((((((....(((((....)))))..((((((...(((.(((((((((...(((.....((..((.----------------------------))..))...)).)...)))))))))))).......)))))).....((((((((((.....))))))))))....(((......)))...(((((((...((([[[...(.((((((.....((...........(((.((((((((((.......(((((.(((..(((.........)))..)))........(((......)))..)))))...)))))))))))))..........]]]))....))))))))))...)))))))(((((((.......)))))..))....))))))(.(.((((((((......((((((((....))))))))...)))))))).)..).....))))))((.....((.......((((((.......))))))((((....((((..((..(((((((...((.....)).))))))....[[(((.((...((((((.((.....))..)))))).....))...(((((........)))))]]((((((((.......(((...((((((((...((((((((((((..-{{.))))))(...(((((....(((((....(((.....))).....))))).....)))))....)(....)))))))...))))))))(...)....)))..)))))))).))).))).....((......)).))))..(((.......)))..))))...((((.....((((((((.((..(....(.......(((((....(.[..).....)))))(((((((((.....)))))))))(...).......(((((((((...((.........))...(((((((.....(((....))).......))))))).].(((.(((..(((((((..(((.....((((......)))).....))))))))..)))))((...------------))........((..........(((((.......)))))..)..)....)))....)).))))))).)..))).)))))))).))))))....)))[[..(((((.....>]])))))..(((((((..(((.((......((((.((((((..(((((.((((((((..(((----------------------------------------------------------------------------------------------------..)))...((((....)))).....))))))))..)))))..(((......[)).)((((((..........]))))))([((...(((((((.(.((((((-----..))))))...).((][.[[[))....)))))))...(((((((((.........))))))))).(((....))).))]]].].....(((((.(((((.]]]]]]))))))))))....).....))))..)))))).......((((.(.((((((...((.......))...))))))...)))).).......(((((.((((((..(((((((((......))))))..)))..((((.....))))......)))))..)...))).))....(((((((....))).))))....))..))).)))))))....--((((((...((((..((((((((.....(....)....))))))))(((((...((((...((((((((((}}..)))))...))))).[.)))).)))))..(((....((((.............))))....))).)))).......)))))).....(((((((((.......)))))....(((.((((((((....(((((..(....)..)))))...))))]))))..)))...))))..---------
>strand_9
uUAGGCGGCCACAGCGGUGGGGUUGCCUCCCGUACCCAUCCCGAACACGGAAGAUAAGCCCACCAGCGUUCCGGGGAGUACUGGAGUGCGCGAGCCUCUGGGAAACCCGGUUCGCCGCCACC
...((((((....((((((((......((((((...(.....)...))))..))....)))))).))...(((((.....((((((.((....))))))))....)))))...))))))...
>strand_3
GCGGAUUCUGUGCACAGAAUUCGCACCA
((((----------------))))....