You are 3032529 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1QLN 1QLN N, R, T1NUCLEOTIDYLTRANSFERASEX-Ray Difraction2.41999-09-01


model 1
>strand_N
uaauacgacucacuAnA
(((((((((((((.---
>strand_R
gGG
.((
>strand_T
cucccuauagugagucguauua
..)).....)))))))))))))