You are 3033024 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1NNE PD0388 C, D1DNA BINDING PROTEIN/DNAX-Ray Difraction3.112003-01-13


model 1
>strand_C
gcgacgcuagcgugcggcucguc
...((((((((..((.(((((((
>strand_D
ggacgagccgccgcuagcgucg
.))))))).)).))))))))..