You are 3033014 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1NG9 PD0367 E, F1DNA BINDING PROTEINX-Ray Difraction2.62002-12-17


model 1
>strand_E
agcugccaggcaccagugucagcguccuau
.(((((((.(((((((..------------
>strand_F
auaggacgcugacacuggugcuuggcagcu
-------------.))))))).))))))).