You are 3033023 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1NBS UR0027 A, B1RNAX-Ray Difraction3.152002-12-03


model 1
>strand_A
gCGAGCCUAGCGAAGUCAUAAGCUAGGGCAGUCUUUAGAGGCUGACGGCAGGAAAAAAGCCUACGUCUUCGGAUAUGGCUGAGUAUCCUUGAAAGUGCCACAGUGACGAAGUCUCACUAGAAAUGGUGAGAGUGGAACGCGGUAAACCCCUCGCA
(((((((((((.....[....))))))((((((......))))).)((.((((....-----------------------.....)))).....(((((............((.(------------).)).........)))..))))))))).
>strand_B
GCGAGCCUAGCGAAGUCAUAAGCUAGGGCAGUCUUUAGAGGCUGACGGCAGGAAAAAAGCCUACGUCUUCGGAUAUGGCUGAGUAUCCUUGAAAGUGCCACAGUGACGAAGUCUCACUAGAAAUGGUGAGAGUGGAACGCGGUAAACCCCUCGCA
(((((((((((..........))))))((((((..----))))).)((.((((....((((...(((....)))..)))).....)))).....(((((............((((((((....))))))))...].....)))..)))))))))-