You are 3032528 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1MSW PD0345 T, N, R1TRANSCRIPTION/DNA/RNAX-Ray Difraction2.12002-09-19


model 1
>strand_T
gccgugcgcauucgccgugu
......[.[..(((((((..
>strand_N
uuuacguugcgcacggc
........].]......
>strand_R
gACACGGCGA
...)))))))