You are 3032969 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1LC4 DR0007 A, B1RNAX-Ray Difraction2.542002-04-05


model 1
>strand_A
UUgCGUCACACCGGUGAAGUCGC
--(((.(.((((((((..(.(((
>strand_B
UUGCGUCACACCGGUGAAGUCGC
--))).).))))))))..).)))