You are 3032525 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1KOG PR0064 I, J, K, L, M, N, O, P1LIGASE/RNAX-Ray Difraction3.52001-12-20


model 1
>strand_I
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))
>strand_J
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))
>strand_K
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
.(((((.(((((...........)))))...))))).
>strand_L
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))
>strand_M
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))
>strand_N
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))
>strand_O
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))
>strand_P
GGCGUAUGUGAUCUUUCGUGUGGGUCACCACUGCGCC
((((((.(((((((.......)))))))...))))))