You are 3033029 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1JWL PD0250 D, E1TRANSCRIPTION/DNAX-Ray Difraction42001-09-04


model 1
>strand_D
agaauugugagcggauaacaauu
-----(((((((((.((((----
>strand_E
uaauuguuauccgcucacaauuc
-----)))).)))))))))----