You are 3032956 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1J2B PR0093 C, D1TRANSFERASE/RNAX-Ray Difraction3.32002-12-29


model 1
>strand_C
GGGCCCGUGGUCUAGUUGGUCAUGACGCCGCCCUUACGAGGCGGAGGUCCGGGGUUCAAGUCCCCGCGGGCCCACCA
(((((((................(((..((((.......))))...)))(((((.......))))))))))))....
>strand_D
GGGCCCGUGGUCUAGUUGGUCAUGACGCCGCCCUUACGAGGCGGAGGUCCGGGGUUCAAGUCCCCGCGGGCCCACCA
(((((((..........------(.(..((((.......))))...).)(...............))))))))....