You are 3033336 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1IVS PR0069 C, D1LIGASE/RNAX-Ray Difraction2.92002-03-29


model 1
>strand_C
GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA
(((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))....
>strand_D
GGGCGGCUAGCUCAGCGGAAGAGCGCUCGCCUCACACGCGAGAGGUCGUAGGUUCAAGUCCUACGCCGCCCACCA
(((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))....