You are 3033962 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1I6U PR0047 C, D1RIBOSOMEX-Ray Difraction2.62001-03-05


model 1
>strand_C
GGGCCCGGUAAGUCUCUUCGGAGAUACUGCCGGGCCC
(((((((((.((((((....))))..)))))))))))
>strand_D
GGGCCCGGUAAGUCUCUUCGGAGAUACUGCCGGGCCC
(((((((((.((((((....))))..)))))))))))