You are 3033185 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1HYS PH0003 E, F1TRANSFERASE/DNA-RNA HYBRIDX-Ray Difraction32001-01-22


model 1
>strand_E
uCAGCCACUUUUUAAAAGAAAAG
.(((((((((((((..((..(((
>strand_F
cuuuucuuuuaaaaaguggcug
)))...)).)))))))))))))