You are 3032526 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1HMH UHX026 A, B, C, D, E, F1RIBOZYMEX-Ray Difraction2.61995-06-06


model 1
>strand_A
GGCGACCCUGAUGAGGCCGAAAGGCCGAAACCGU
(((((((.......((((....))))....((((
>strand_B
acggucggucgcc
))))..)))))))
>strand_C
GGCGACCCUGAUGAGGCCGAAAGGCCGAAACCGU
(((((((.......((((....))))....((((
>strand_D
acggucggucgcc
))))..)))))))
>strand_E
GGCGACCCUGAUGAGGCCGAAAGGCCGAAACCGU
(((((((.......((((....))))....((((
>strand_F
acggucggucgcc
))))..)))))))