You are 3033196 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1GM5 1GM5 X, Y, Z1HELICASEX-Ray Difraction3.242001-09-11


model 1
>strand_X
cagcuccaugauCAnnGGCA
.[[[.[[[[...--------
>strand_Y
gcagugcucgcauggagcug
.((((((((..]]]].]]].
>strand_Z
gagcacugc
)))))))).