You are 2860751 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1FW6 PD0181 C, D1REPLICATION/DNAX-Ray Difraction2.72000-09-21


model 1
>strand_C
gcgacgcuagcgugcggcucguc
...(((((((((.((.((((((.
>strand_D
ggacgagccgccgcuagcgucg
..)))))).)))))))))))..