You are 2862814 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1FMN 1FMN A5RNANMR1995-12-04



models:   1   2   3   4   5

 model 1, 2, 4 
>strand_A
GGCGUGUAGGAUAUGCUUCGGCAGAAGGACACGCC
(((((((......(((....))).....)))))))
 model 3, 5 
>strand_A
GGCGUGUAGGAUAUGCUUCGGCAGAAGGACACGCC
(.(((((......(((....))).....))))).)