You are 2860751 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1EGK UH0002 A, B, C, D1DNA-RNA HYBRIDX-Ray Difraction3.12000-02-15


model 1
>strand_A
aGGAGAGAGaUGGGUGCGAG
.((((((((.((((((((((
>strand_B
cucgcacccaggcuagcuacaacgacucucuccu
)))))))))).(((((((.(...))((((((((.
>strand_C
aGGAGAGAGaUGGGUGCGAG
.)))))))).((((((((((
>strand_D
cucgcacccaggcuagcuacaacgacucucuccu
)))))))))).))))))(.(...)))))))))).