You are 2889283 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1A4D 1A4D A, B1RNANMR1998-01-29


model 1
>strand_A
gGCCGAUGGUAGUGUGGGGUC
((((.......(((((((...
>strand_B
UCCCCAUGCGAGAGUAGGCC
..))))))).......))))