You are 2890062 visitor.
Currently 6 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1ET4 DR0004 A, B, C, D, E1RNAX-Ray Difraction2.32000-04-12


model 1
>strand_A
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_B
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_C
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_D
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..
>strand_E
GGAACCGGUGCGCAUAACCACCUCAGUGCGAGCAA
......(((.{[[....[[)))...].].}.]]..