You are 2862400 visitor.
Currently 8 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1EIY PR0024 C1LIGASE/RNAX-Ray Difraction3.32000-02-29


model 1
>strand_C
GCCGAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCCGCGGUUCGAUUCCGCGCCUCGGCACCA
(((((((..((((.....[..)))).(((((.......))))).....(((((..]....))))))))))))....