You are 2890063 visitor.
Currently 7 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
1C2X C1RIBOSOMEElectron Microscopy7.51999-07-28


model 1
>strand_C
UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU
((((((((((.....((((((((.......((((.............))))........)))))).)).((.......(((((((.....))))))).......))...)))))))))).