You are 3231457 visitor.
Currently 9 users online.


Sequence & secondary structure in dot-bracket notation
       
 PDB id   NDB id  Strands     Number of models     Functional class     Experimental method     Resolution [Å]     PDB deposition
2OIU UR0110 P, Q1RNAX-Ray Difraction2.62007-01-11


model 1
>strand_P
gGACCUCGGCGAAAGCCGUUCGACCAGCGAAAGCUCUUAGACAGGAGGUUAGGUGCUCCGAAAGGAGCACU
.(((((((((....)))(.((....(((....)))....)))..)))))).((((((((....))))))))
>strand_Q
GGACCUCGGCGAAAGCCGUUCGACCAGCGAAAGCUCUUAGACAGGAGGUUAGGUGCUCCGAAAGGAGCACU
.(((((((((....)))(.((....(((....)))....)))..)))))).((((((((....))))))))